*******************************************************************
* ** Instructions ** for doing projects
* sample project report #1
* sample project report #2
*
*Note**** If you are interested in doing a particular project you *
* should let me know. Some of the project descriptions have*
* been revised and updated. I have some links that may also*
* help you. Late projects lose 10% a day off the top. *
********************************************************************
projects received
ALL projects for CMSC 655/455 during 2011 should be chosen from
those listed below ------
BE CAREFUL to notice DUE DATES
*****Note******
Each undergraduate is required to do two projects
(from those marked with a U)
Each grad student is required to do three projects
(from those marked with a G)
***********************due dates **************************************
* *
* phase one --- due date Oct. 27 (Thursday) *
* ***note change***
y*
* U indicates available to undergraduates *
* G indicates available to graduates but may have *
* additional requirements *
* *
* U,G *1. Robotic Arm Movement and Reachability Project* *
* interested students should ask for a handout
* or check link robotarm project
*.. describing the project --- *
*
* U,G *2. Finding the temperature of a thin metal plate where *
* a rectangle in the middle has been removed*. Some *
matlab code is furnished. Opportunity for extra credit. *
see directions
* Bottom of page two in pdf is missing the following
"This will enable you to make sure your answers are correct.
No displays need to be done. This particular case does not
need to be included in your final write-up. *
b) Solve the more serious case with n = 17. Set up the..." *
----------------------------------------------------------------
matlab code 1
iterative methods matlab code
* matconstruct.m *
another matrix construct
----------------------------------------------------------------
With reference to part c) graduate students should also *
attempt to solve the equations using 'Multi-Grid'. This *
package can be obtained from the internet or from me. *
*
* multigrid software see source
ref. 1 with links to demos
ref.2 sample code
*
****For your reading enjoyment ****
*D U,G .Truss computations* *
* interested students should ask for a handout describing *
* the specifications and requirements or follow link *
* truss project .
*
3. U,G One dimensional flow of a viscous, compressible fluid
link to project
An exercise in solving non-linear equations
4. U,G Alternative problem -- solving the non-linear equations
resulting from Burgers equation
link to project
5. U,G Interpolation Project
instructions
help file
6. U,G Chemicals and Refrigerators
instructions
----------------------------------------------------------------------------
------------------------------------------------------------------------------
JPL's Welcome to the Planets Site Where are the planet's today?
and in case you really start getting interested
What are Keplerian Elements?
The earth in space
Mercury's orbital precession
Mercury's orbital precession II
Two body problem..reduced mass..derivation of equations
A Numerical Calculation of the Nonrelativistic Contribution to the Precession of Mercury's Perihelion
-----------------------------------------------------------------------------
* U,G *6 Solving the famous Lorentz equations
* project description
***********************************************************************
* *
* projects - phase 2 due date Dec. 6 *
* *
***********************************************************************
7. Apollo problem..handed out in class
*
* U,G *8 Predator Prey computations*
* description
* For U, teams of two allowed
U,G *9 Travelling Salesman Problem
instructions here
LCS problem
Project 10 (Bioinformatics) limited to 5 teams of two
Project 10 involves solving a computer science problem and its
variant that occurs in the study of DNA sequencing (bioinformatics).
See the references listed below for a more detailed discussion
of this problem. Some of these references give algorithms (and
even code) for attacking the problem. You may use this information
but you must reference it in your project report. This project
like the Traveling Salesman Problem (TSP) is competitive.
This problem is called --
the "Longest Common Subsequence Problem" (LCS)
and is a discrete problem as are projects 3 and 7 above.
The variant of the problem is the "Longest Common
Substring Problem" also described in some of the references below.
Teams of two may submit this project as well as individuals.
The LCS problem is :---------------------------------------------
given a set S of strings {S_1,.......,S_n} what is the longest
string S' such that the characters of S' appear as a subsequence
of each string S_i in the set S? Its Variant is the "Longest
Common Substring Problem" where the characters of S' must appear
as substrings not just subsequences.
For instance S might just contain two strings such as:
GGATACGTTACCTGATTTACGGCAT and
GAATACCTAGAGTTACTTA
and GATCTTTT would be a common subsequence (but not the longest).
These strings would represent DNA sequences.
-----------------------------------------------------------
In this project there are three strings in the set S.
string 1
string 2
string 3
.
11. U,G Simulation Texas Hold'em
see handout
Texas Hold'em Simulation
The purpose of this project is to give you some experience and skill in the
area of simulation. Simulation can be used to give us approximate answers to
questions that are too difficult to analyze by usual means. In this particular
case we consider a game of recent popularity -hold'em- a form of poker which
is used in recent televised tournaments.
For the rules of "hold'em" see
first reference
second reference
The goal is to compute certain probabilities by simulation that we cannot
compute in any other manner. In the televised tournaments that I have mentioned
the audience is able to see the players two hidden cards. For instance, player
1 may have a pair of sevens and player two may have a jack and a four. Which
player has the highest probability of winning? This problem reduces to which
player's cards together with those cards in the flop (three cards..later
followed by two more cards ) will form the
best poker hand. These televised tournaments usually show the viewer each
player's probability of winning and this is continually revised as cards in the
flop are turned up (the first three, and then the final two one by one).
These probabilities are too difficult to compute analytically and can be
estimated by simulation. For instance, considering the two hands mentioned
above for players one and two the resulting outcomes can be computed for
10,000 outcomes and the resulting frequencies computed as probabilities.
Basically this means (assuming that there are only two players) the remaining
deck, minus the players cards, is used to deal the flop and turn and river
cards. If there are more
than two players then all cards of all players must be taken into account.
Each game should be able to be simulated very quickly and so these
probabilities can be efficiently computed and one should even be able to
create certain "look up tables". An evaluator will be needed which will
be able to evaluate hands and determine a winner.
In this manner hands can be given"power ratings".See, for example,
wizard of odds
For academic papers is this type of topic see:
Using Probabilisitic Knowledge and Simulation to Play Poker
Opponent Modeling in Poker
In one paper dealing with games of incomplete information simulation is
used to create a Texas Hold'em playing program called Loki.
In this project you are to compute some sample probabilities. Some of
them are given below. A more complete list will be forthcoming.
given below: for instance JH refers to Jack of hearts, etc.
one player -----
player one player two
KS10C random
JC7S random
AH4C random
two players ---
player one player two
JH,JS AC,4C
JH,QD AC,4C
JH,QD AC,10C
JH,QD AC,7D
10D,9D 6H,6D
three players-----
player one player two player three
,JH,JS AC,4C dealt 2, folded
JH,QD AC,4C JS, 10C
JH,QD AC,10C JS, 10S
JH,QD AC,7D "
10D,9D 6H,6D JS, 3C
JH,JS AC,4C JC, 3S flop= 4H,7C,3C
JH,QD AC,9D JC, 9S flop= QH,7C,3C
some helpful code will be supplied for this project
code thanks to Matt Rodatus
code instructions
Andrew Hubbard's modification of Matt's code.
12. 6. U,G Chemicals and Refrigerators
instructions
ODE
-------some links to ODE solvers ------
1. ODE Systems Univ. of Arizona
2. Center of Nonlinear Dynamics in Economics and Finance
3. Dynamics Solver
Interesting links----------------------------
predator prey cellular atomata simulation needs java
population dynamics models
predator prey models
predator prey game
-->