*******************************************************************
        *  ** Instructions **  for doing projects  
        *   sample project report  #1
        *  sample project report  #2
        * 
        *Note**** If you are interested in doing a particular project you  *
        *         should let me know. Some of the project descriptions have*
        *         been revised and updated. I have some links that may also*
        *         help you. Late projects lose 10% a day off the top.      *
        ********************************************************************
              

           

              projects received 

               ALL projects for CMSC 655/455 during 2011 should be chosen from
               those listed below ------
               
               BE CAREFUL to notice DUE DATES
 

               *****Note******
                 Each undergraduate is required to do two projects
                 (from those marked with a U)
                 Each grad student is required to do three projects
                 (from those marked with a G)

              

        ***********************due dates **************************************
        *                                                                     *
        *           phase one ---   due date Oct. 27 (Thursday)               *
        *                                   ***note change***

        y*
        *       U  indicates available to undergraduates                      *
        *       G  indicates available to graduates but may have              * 
        *          additional requirements                                    *        
        *                                                                     *
        * U,G *1. Robotic Arm Movement and Reachability Project*               * 
        *         interested students should ask for a handout          
        *         or check link  robotarm project          
        *..       describing the project ---                                  *
        *                
        * U,G *2. Finding the temperature of a thin metal plate where         *
        *        a rectangle in the middle has been removed*. Some            *
                 matlab code is furnished. Opportunity for extra credit.      *
                 see  directions   
        *        Bottom of page two in pdf is missing the following
                 "This will enable you to make sure your answers are correct.
                 No displays need to be done. This particular case does not
                 need to be included in your final write-up.                  *
                 b) Solve the more serious case with n = 17. Set up the..."   *

                  ----------------------------------------------------------------
                  matlab code 1  
                  iterative methods  matlab code
        *          matconstruct.m                 *
                   another matrix construct 
                  ----------------------------------------------------------------

                 With reference to part c) graduate students should also      *
                 attempt to solve the equations using 'Multi-Grid'. This      *
                 package can be obtained from the internet or from me.        *
        *                                                                     
        *          multigrid software see source
                  ref. 1  with links to demos
                   ref.2  sample code
               
        *    
            ****For your reading enjoyment ****
        
        *D  U,G .Truss computations*                                         *
        *        interested students should ask for a handout describing      *             
        *        the specifications and requirements or follow link           *
        *         truss project .    
        *  

        3.  U,G  One dimensional flow of a viscous, compressible fluid

                   link to project 
                
                  An exercise in solving non-linear equations

        4.  U,G  Alternative problem -- solving the non-linear equations
                 resulting from Burgers equation

                  link to project  

        5.  U,G  Interpolation Project
                     instructions  
                      help file 
        6.  U,G  Chemicals and Refrigerators

                     instructions 

----------------------------------------------------------------------------

  
------------------------------------------------------------------------------
         
 
                  JPL's Welcome to the Planets Site Where are the planet's today?
                  and in case you really start getting interested 
What are Keplerian Elements?
The earth in space
 Mercury's orbital precession
 Mercury's orbital precession II
 Two body problem..reduced mass..derivation of equations
A Numerical Calculation of the Nonrelativistic Contribution to the Precession of  Mercury's Perihelion
  
 -----------------------------------------------------------------------------
                
        *   U,G  *6  Solving the famous Lorentz equations
        *             project  description
        


        ***********************************************************************
        *                                                                     *
        *           projects - phase 2     due date  Dec. 6                   *
        *                                                                     *
        ***********************************************************************
             
              7.  Apollo problem..handed out in class


                                                                             * 
        * U,G *8  Predator Prey computations*      
        *               description  
        *          For U, teams of two allowed           
   
          U,G *9  Travelling Salesman Problem      
                   instructions here
           

                       LCS problem
      Project 10  (Bioinformatics) limited to 5 teams of two

         Project 10 involves solving a computer science problem and its
         variant that occurs in the study of DNA sequencing (bioinformatics). 
         See the references listed below for a more detailed discussion 
         of this problem. Some of these references give algorithms (and
         even code) for attacking the problem. You may use this information
         but you must reference it in your project report. This project
         like the Traveling Salesman Problem (TSP) is competitive.
         This problem is called -- 
         the "Longest Common Subsequence Problem" (LCS) 
         and is a discrete problem as are projects 3 and 7 above. 
         The variant of the problem is the "Longest Common
         Substring Problem" also described in some of the references below.
         Teams of two may submit this project as well as individuals.


         The LCS problem is :---------------------------------------------

           given a set S of strings {S_1,.......,S_n} what is the longest
 
           string S' such that the characters of S' appear as a subsequence

           of each string S_i in the set S? Its Variant is the "Longest

           Common Substring Problem" where the characters of S' must appear

           as substrings not just subsequences.

           For instance S might just contain two strings such as:

              GGATACGTTACCTGATTTACGGCAT  and

                  GAATACCTAGAGTTACTTA

          and GATCTTTT would be a common subsequence (but not the longest).

          These strings would represent DNA sequences.
          -----------------------------------------------------------         

          In this project there are three strings in the set S.
           string 1 
          string 2 
          string 3 
.
  11. U,G      Simulation Texas  Hold'em 
                 see handout


                                                        

                    Texas Hold'em Simulation

           The purpose of this project is to give you some experience and skill in the
            area of simulation. Simulation can be used to give us approximate answers to 
            questions that are too difficult to analyze by usual means. In this particular
            case we consider a game of recent popularity  -hold'em- a form of poker which
            is used in recent televised tournaments.
                For the rules of "hold'em" see
                  first  reference
                   second  reference
             The goal is to compute certain probabilities by simulation that we cannot
             compute in any other manner. In the televised tournaments that I have mentioned
             the audience is able to see the players two hidden cards. For instance, player
             1 may have a pair of sevens and player two may have a jack and a four. Which 
             player has the highest probability of winning? This problem reduces to which 
             player's cards together with those cards in the flop (three cards..later 
             followed by two more cards ) will form the
             best poker hand. These televised tournaments usually show the viewer each
             player's probability of winning and this is continually revised as cards in the
             flop are turned up (the first three, and then the final two one by one).
 
               These probabilities are too difficult to compute analytically and can be
             estimated by simulation. For instance, considering the two hands mentioned
             above for players one and two the resulting outcomes can be computed for
             10,000 outcomes and the resulting frequencies computed as probabilities.
              Basically this means (assuming that there are only two players) the remaining 
              deck, minus the players cards, is used to deal the flop and turn and river
              cards. If there are more
              than two players then all cards of all players must be taken into account.
    
               Each game should be able to be simulated very quickly and so these 
               probabilities can be efficiently computed and one should even be able to 
               create certain "look up tables". An evaluator will be needed which will
               be able to evaluate hands and determine a winner. 
               In this manner hands can be given"power ratings".See, for example,

               wizard of odds 


                

     For academic papers is this type of topic see:

        Using  Probabilisitic Knowledge and Simulation to Play Poker 

        Opponent  Modeling in Poker

     In one paper dealing with games of incomplete information simulation is
 used to create a Texas Hold'em playing program called Loki.

     In this project you are to compute some sample probabilities. Some of
them are given below. A more complete list will be forthcoming.
given below:  for instance JH refers to Jack of hearts, etc.



      one player -----

          player one              player two

          KS10C                    random
          JC7S                     random
          AH4C                     random



      two players ---


        player one                           player two

         JH,JS                                  AC,4C
         JH,QD                                  AC,4C
         JH,QD                                  AC,10C
         JH,QD                                  AC,7D
         10D,9D                                6H,6D
         

       three players-----

        player one            player two       player three

        ,JH,JS                  AC,4C           dealt 2, folded
         JH,QD                  AC,4C             JS, 10C 
         JH,QD                  AC,10C            JS, 10S
         JH,QD                  AC,7D              "
         10D,9D                 6H,6D             JS, 3C

                  JH,JS                  AC,4C             JC, 3S   flop= 4H,7C,3C 
         JH,QD                  AC,9D             JC, 9S   flop= QH,7C,3C

           

           
                 some helpful code will be supplied for this project
                  code  thanks to Matt Rodatus
                  code instructions 
                  Andrew Hubbard's modification of Matt's code.            


     12.   6.  U,G  Chemicals and Refrigerators

                     instructions 







              
         ODE

                 -------some links to ODE solvers ------

                   1.  ODE Systems   Univ. of Arizona
                   2.  Center of Nonlinear Dynamics in Economics and Finance 
                   3.   Dynamics Solver 




          

             Interesting links----------------------------
                                                                                
              predator prey cellular atomata simulation  needs java
               population dynamics models 
               predator prey models 
               predator prey game 
 -->